7 Copyright (C) The Arvados Authors. All rights reserved.
9 SPDX-License-Identifier: CC-BY-SA-3.0
12 {% include 'crunch1only_begin' %}
13 On those sites, the features described here are not yet implemented.
14 {% include 'crunch1only_end' %}
16 The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvados compute nodes.
18 {% include 'tutorial_expectations' %}
22 Using @arv-run@ you can write and test command lines interactively, then insert @arv-run@ at the beginning of the command line to run the command on Arvados. For example:
26 $ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
27 $ <span class="userinput">ls *.fastq</span>
28 HWI-ST1027_129_D0THKACXX.1_1.fastq HWI-ST1027_129_D0THKACXX.1_2.fastq
29 $ <span class="userinput">grep -H -n ATTGGAGGAAAGATGAGTGAC HWI-ST1027_129_D0THKACXX.1_1.fastq</span>
30 HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
31 HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
32 HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
33 $ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC HWI-ST1027_129_D0THKACXX.1_1.fastq</span>
34 Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
36 0 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq
37 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
38 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
39 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
40 0 stderr run-command: completed with exit code 0 (success)
45 A key feature of @arv-run@ is the ability to introspect the command line to determine which arguments are file inputs, and transform those paths so they are usable inside the Arvados container. In the above example, @HWI-ST1027_129_D0THKACXX.1_2.fastq@ is transformed into @/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq@. @arv-run@ also works together with @arv-mount@ to identify that the file is already part of an Arvados collection. In this case, it will use the existing collection without any upload step. If you specify a file that is only available on the local filesystem, @arv-run@ will upload a new collection.
47 If you find that @arv-run@ is incorrectly rewriting one of your command line arguments, place a backslash @\@ at the beginning of the affected argument to quote it (suppress rewriting).
51 @arv-run@ will parallelize over files listed on the command line after @--@.
55 $ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
56 $ <span class="userinput">ls *.fastq</span>
57 HWI-ST1027_129_D0THKACXX.1_1.fastq HWI-ST1027_129_D0THKACXX.1_2.fastq
58 $ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq</span>
59 Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
61 0 stderr run-command: parallelizing on input0 with items [u'/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq', u'/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq']
63 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq
64 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq
66 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
67 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
68 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
69 1 stderr run-command: completed with exit code 0 (success)
70 2 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq:34:CTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAG
71 2 stderr run-command: completed with exit code 0 (success)
75 You may specify @--batch-size N@ (or the short form @-bN@) after the @--@ but before listing any files to specify how many files to provide put on the command line for each task. See "Putting it all together" below for an example.
79 You may use standard input (@<@) and standard output (@>@) redirection. This will create a separate task for each file listed in standard input. You are only permitted to supply a single file name for stdout @>@ redirection. If there are multiple tasks with their output sent to the same file, the output will be collated at the end of the pipeline.
81 (Note: because the syntax is designed to mimic standard shell syntax, it is necessary to quote the metacharacters @<@, @>@ and @|@ as either @\<@, @\>@ and @\|@ or @'<'@, @'>'@ and @'|'@.)
83 {% include 'arv_run_redirection' %}
85 You may use "run-command":run-command.html parameter substitution in the output file name to generate different filenames for each task:
89 $ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
90 $ <span class="userinput">ls *.fastq</span>
91 $ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> '$(task.uuid).txt'</span>
93 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
94 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > qr1hi-ot0gb-iu2xgy4hkx4mmri.txt
95 1 stderr run-command: completed with exit code 0 (success)
96 1 stderr run-command: the following output files will be saved to keep:
97 1 stderr run-command: 363 ./qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
98 1 stderr run-command: start writing output to keep
99 1 stderr upload wrote 363 total 363
100 2 stderr run-command: completed with exit code 0 (success)
101 2 stderr run-command: the following output files will be saved to keep:
102 2 stderr run-command: 121 ./qr1hi-ot0gb-iu2xgy4hkx4mmri.txt
103 2 stderr run-command: start writing output to keep
104 2 stderr upload wrote 121 total 121
111 Multiple commands may be connected by pipes and execute in the same container:
115 $ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
116 $ <span class="userinput">ls *.fastq</span>
117 $ <span class="userinput">arv-run cat -- *.fastq \| grep -H -n ATTGGAGGAAAGATGAGTGAC \> output.txt</span>
119 1 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
120 2 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
125 If you need to capture intermediate results of a pipe, use the @tee@ command.
127 h2. Running a shell script
131 $ <span class="userinput">echo 'echo hello world' > hello.sh</span>
132 $ <span class="userinput">arv-run /bin/sh hello.sh</span>
133 Upload local files: "hello.sh"
134 Uploaded to qr1hi-4zz18-23u3hxugbm71qmn
135 Running pipeline qr1hi-d1hrv-slcnhq5czo764b1
137 0 stderr run-command: /bin/sh /keep/5d3a4131b7d8f233f2a917d8a5c3c2b2+52/hello.sh
139 0 stderr run-command: completed with exit code 0 (success)
144 h2. Additional options
146 * @--docker-image IMG@ : By default, commands run based in a container created from the @default_docker_image_for_jobs@ setting on the API server. Use this option to specify a different image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
147 * @--dry-run@ : Print out the final Arvados pipeline generated by @arv-run@ without submitting it.
148 * @--local@ : By default, the pipeline will be submitted to your configured Arvados instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
149 * @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g., @grep@ returns 1 when no match is found). Set this to indicate that commands that return non-zero return codes should not be considered failed.
150 * @--no-wait@ : Do not wait and display logs after submitting command, just exit.
152 h2. Putting it all together: bwa mem
156 $ <span class="userinput">cd ~/keep/by_id/d0136bc494c21f79fc1b6a390561e6cb+2778</span>
157 $ <span class="userinput">arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'</span>
158 0 stderr run-command: parallelizing on input0 with items [[u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz'], [u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz']]
160 1 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz > qr1hi-ot0gb-a4bzzyqqz4ubair.sam
161 2 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz > qr1hi-ot0gb-14j9ncw0ymkxq0v.sam