From 761c4fd02d57e4e8c1190a94a3956e9de9f643df Mon Sep 17 00:00:00 2001
From: Tom Clegg <tom@tomclegg.ca>
Date: Mon, 20 Jan 2020 09:54:26 -0500
Subject: [PATCH] Include ending tag in tile sequence.

Arvados-DCO-1.1-Signed-off-by: Tom Clegg <tom@tomclegg.ca>
---
 taglib.go      |  9 ++-------
 taglib_test.go | 18 ++++++++++++------
 tilelib.go     |  4 ++--
 3 files changed, 16 insertions(+), 15 deletions(-)

diff --git a/taglib.go b/taglib.go
index 367b9c4fff..91d4d4df29 100644
--- a/taglib.go
+++ b/taglib.go
@@ -39,12 +39,7 @@ func (taglib *tagLibrary) Load(rdr io.Reader) error {
 	return taglib.setTags(seqs)
 }
 
-type tagMatch struct {
-	id  tagID
-	pos int
-}
-
-func (taglib *tagLibrary) FindAll(buf []byte, fn func(id tagID, pos int)) {
+func (taglib *tagLibrary) FindAll(buf []byte, fn func(id tagID, pos, taglen int)) {
 	var key tagmapKey
 	for i := 0; i <= len(buf)-taglib.keylen; i++ {
 		copy(key[:taglib.keylen], buf[i:])
@@ -54,7 +49,7 @@ func (taglib *tagLibrary) FindAll(buf []byte, fn func(id tagID, pos int)) {
 			// key portion matches, but not the entire tag
 			continue
 		} else {
-			fn(taginfo.id, i)
+			fn(taginfo.id, i, len(taginfo.tagseq))
 			i += len(taginfo.tagseq) - 1 // don't try to match overlapping tags
 		}
 	}
diff --git a/taglib_test.go b/taglib_test.go
index c023ab5fcc..fbddc81904 100644
--- a/taglib_test.go
+++ b/taglib_test.go
@@ -19,6 +19,12 @@ type taglibSuite struct{}
 
 var _ = check.Suite(&taglibSuite{})
 
+type tagMatch struct {
+	id     tagID
+	pos    int
+	taglen int
+}
+
 func (s *taglibSuite) TestFindAllTinyData(c *check.C) {
 	pr, pw, err := os.Pipe()
 	c.Assert(err, check.IsNil)
@@ -35,10 +41,10 @@ gactctagcagagtggccagccac
 	c.Assert(err, check.IsNil)
 	haystack := []byte(`ggagaactgtgctccgccttcagaccccccccccccccccccccacacatgctagcgcgtcggggtgggggggggggggggggggggggggggactctagcagagtggccagccac`)
 	var matches []tagMatch
-	taglib.FindAll(haystack, func(id tagID, pos int) {
-		matches = append(matches, tagMatch{id, pos})
+	taglib.FindAll(haystack, func(id tagID, pos, taglen int) {
+		matches = append(matches, tagMatch{id, pos, taglen})
 	})
-	c.Check(matches, check.DeepEquals, []tagMatch{{0, 0}, {1, 44}, {2, 92}})
+	c.Check(matches, check.DeepEquals, []tagMatch{{0, 0, 24}, {1, 44, 24}, {2, 92, 24}})
 }
 
 func (s *taglibSuite) TestFindAllRealisticSize(c *check.C) {
@@ -80,10 +86,10 @@ func (s *taglibSuite) TestFindAllRealisticSize(c *check.C) {
 	c.Assert(err, check.IsNil)
 	c.Logf("@%v find tags in input", time.Since(start))
 	var matches []tagMatch
-	taglib.FindAll(haystack, func(id tagID, pos int) {
-		matches = append(matches, tagMatch{id, pos})
+	taglib.FindAll(haystack, func(id tagID, pos, taglen int) {
+		matches = append(matches, tagMatch{id, pos, taglen})
 	})
 	c.Logf("@%v done", time.Since(start))
-	c.Check(matches[0], check.Equals, tagMatch{0, 0})
+	c.Check(matches[0], check.Equals, tagMatch{0, 0, tagsize})
 	c.Check(matches[1].id, check.Equals, tagID(1))
 }
diff --git a/tilelib.go b/tilelib.go
index cf06bb93ce..cfe91fb49f 100644
--- a/tilelib.go
+++ b/tilelib.go
@@ -61,9 +61,9 @@ func (tilelib *tileLibrary) TileFasta(filelabel string, rdr io.Reader) (tileSeq,
 		var path []tileLibRef
 		tilestart := -1        // position in fasta of tile that ends here
 		tiletagid := tagID(-1) // tag id starting tile that ends here
-		tilelib.taglib.FindAll(job.fasta, func(id tagID, pos int) {
+		tilelib.taglib.FindAll(job.fasta, func(id tagID, pos, taglen int) {
 			if tilestart >= 0 {
-				path = append(path, tilelib.getRef(tiletagid, job.fasta[tilestart:pos]))
+				path = append(path, tilelib.getRef(tiletagid, job.fasta[tilestart:pos+taglen]))
 			}
 			tilestart = pos
 			tiletagid = id
-- 
2.30.2