X-Git-Url: https://git.arvados.org/arvados.git/blobdiff_plain/3db43f179cf2fe1fb4077f8789d2b53588806517..a50278e3d0e26bb5d513d0af5da2fb559b112388:/doc/user/topics/arv-run.html.textile.liquid?ds=inline diff --git a/doc/user/topics/arv-run.html.textile.liquid b/doc/user/topics/arv-run.html.textile.liquid index 91c49c8afb..8d1aca6305 100644 --- a/doc/user/topics/arv-run.html.textile.liquid +++ b/doc/user/topics/arv-run.html.textile.liquid @@ -4,7 +4,7 @@ navsection: userguide title: "Using arv-run" ... -The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvado compute nodes. +The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvados compute nodes. {% include 'tutorial_expectations' %} @@ -43,6 +43,8 @@ h2. Parallel tasks
+$ cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142
+$ ls *.fastq
 HWI-ST1027_129_D0THKACXX.1_1.fastq  HWI-ST1027_129_D0THKACXX.1_2.fastq
 $ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq
 Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
@@ -69,30 +71,14 @@ You may use standard input (@<@) and standard output (@>@) redirection.  This wi
 
 (Note: because the syntax is designed to mimic standard shell syntax, it is necessary to quote the metacharacters @<@, @>@ and @|@ as either @\<@, @\>@ and @\|@ or @'<'@, @'>'@ and @'|'@.)
 
-
-
-$ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> output.txt
-[...]
- 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > output.txt
- 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > output.txt
- 2 stderr run-command: completed with exit code 0 (success)
- 2 stderr run-command: the following output files will be saved to keep:
- 2 stderr run-command: 121 ./output.txt
- 2 stderr run-command: start writing output to keep
- 1 stderr run-command: completed with exit code 0 (success)
- 1 stderr run-command: the following output files will be saved to keep:
- 1 stderr run-command: 363 ./output.txt
- 1 stderr run-command: start writing output to keep
- 2 stderr upload wrote 121 total 121
- 1 stderr upload wrote 363 total 363
-[..]
-
-
+{% include 'arv_run_redirection' %} You may use "run-command":run-command.html parameter substitution in the output file name to generate different filenames for each task:
+$ cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142
+$ ls *.fastq
 $ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> '$(task.uuid).txt'
 [...]
  1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
@@ -117,6 +103,8 @@ Multiple commands may be connected by pipes and execute in the same container:
 
 
 
+$ cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142
+$ ls *.fastq
 $ arv-run cat -- *.fastq \| grep -H -n ATTGGAGGAAAGATGAGTGAC \> output.txt
 [...]
  1 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
@@ -146,9 +134,9 @@ Running pipeline qr1hi-d1hrv-slcnhq5czo764b1
 
 h2. Additional options
 
-* @--docker-image IMG@ : By default, commands run inside a Docker container created from the latest "arvados/jobs" Docker image.  Use this option to specify a different image to use.  Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
+* @--docker-image IMG@ : By default, commands run based in a container created from the @default_docker_image_for_jobs@ setting on the API server.  Use this option to specify a different image to use.  Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
 * @--dry-run@ : Print out the final Arvados pipeline generated by @arv-run@ without submitting it.
-* @--local@ : By default, the pipeline will be submitted to your configured Arvado instance.  Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
+* @--local@ : By default, the pipeline will be submitted to your configured Arvados instance.  Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
 * @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g. @grep@ returns 1 when no match is found).  Set this to indicate that commands that return non-zero return codes should not be considered failed.
 * @--no-wait@ : Do not wait and display logs after submitting command, just exit.
 
@@ -157,7 +145,7 @@ h2. Putting it all together: bwa mem
 
 
 $ cd ~/keep/by_id/d0136bc494c21f79fc1b6a390561e6cb+2778
-$ arv-run --docker-image arvados/jobs-java-bwa-samtools --repository peter --script-version 3609-arv-run  bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'
+$ arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'
  0 stderr run-command: parallelizing on input0 with items [[u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz'], [u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz']]
 [...]
  1 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz > qr1hi-ot0gb-a4bzzyqqz4ubair.sam