X-Git-Url: https://git.arvados.org/arvados.git/blobdiff_plain/370df5a95b6b143885fa4d96be90c51f25f8ad14..4d8209df92198e6207d3d38cbb7a189cb319bf3c:/doc/user/topics/arv-run.html.textile.liquid
diff --git a/doc/user/topics/arv-run.html.textile.liquid b/doc/user/topics/arv-run.html.textile.liquid
index 91c49c8afb..862b19c2c9 100644
--- a/doc/user/topics/arv-run.html.textile.liquid
+++ b/doc/user/topics/arv-run.html.textile.liquid
@@ -4,7 +4,7 @@ navsection: userguide
title: "Using arv-run"
...
-The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvado compute nodes.
+The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvados compute nodes.
{% include 'tutorial_expectations' %}
@@ -69,25 +69,7 @@ You may use standard input (@<@) and standard output (@>@) redirection. This wi
(Note: because the syntax is designed to mimic standard shell syntax, it is necessary to quote the metacharacters @<@, @>@ and @|@ as either @\<@, @\>@ and @\|@ or @'<'@, @'>'@ and @'|'@.)
-
-
-$ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> output.txt
-[...]
- 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > output.txt
- 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > output.txt
- 2 stderr run-command: completed with exit code 0 (success)
- 2 stderr run-command: the following output files will be saved to keep:
- 2 stderr run-command: 121 ./output.txt
- 2 stderr run-command: start writing output to keep
- 1 stderr run-command: completed with exit code 0 (success)
- 1 stderr run-command: the following output files will be saved to keep:
- 1 stderr run-command: 363 ./output.txt
- 1 stderr run-command: start writing output to keep
- 2 stderr upload wrote 121 total 121
- 1 stderr upload wrote 363 total 363
-[..]
-
-
+{% include 'arv_run_redirection' %}
You may use "run-command":run-command.html parameter substitution in the output file name to generate different filenames for each task:
@@ -148,7 +130,7 @@ h2. Additional options
* @--docker-image IMG@ : By default, commands run inside a Docker container created from the latest "arvados/jobs" Docker image. Use this option to specify a different image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
* @--dry-run@ : Print out the final Arvados pipeline generated by @arv-run@ without submitting it.
-* @--local@ : By default, the pipeline will be submitted to your configured Arvado instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
+* @--local@ : By default, the pipeline will be submitted to your configured Arvados instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
* @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g. @grep@ returns 1 when no match is found). Set this to indicate that commands that return non-zero return codes should not be considered failed.
* @--no-wait@ : Do not wait and display logs after submitting command, just exit.
@@ -157,7 +139,7 @@ h2. Putting it all together: bwa mem
$ cd ~/keep/by_id/d0136bc494c21f79fc1b6a390561e6cb+2778
-$ arv-run --docker-image arvados/jobs-java-bwa-samtools --repository peter --script-version 3609-arv-run bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'
+$ arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'
0 stderr run-command: parallelizing on input0 with items [[u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz'], [u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz']]
[...]
1 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz > qr1hi-ot0gb-a4bzzyqqz4ubair.sam