title: "Using arv-run"
...
-The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvado compute nodes.
+The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvados compute nodes.
{% include 'tutorial_expectations' %}
-h1. Quick introduction
+h1. Usage
-Run one @grep@ task per file, and redirect the output to output.txt
+Using @arv-run@ you can write and test command lines interactively, then insert @arv-run@ at the beginning of the command line to run the command on Arvados. For example:
<notextile>
<pre>
$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
-$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq \> output.txt</span>
+$ <span class="userinput">ls *.fastq</span>
+HWI-ST1027_129_D0THKACXX.1_1.fastq HWI-ST1027_129_D0THKACXX.1_2.fastq
+$ <span class="userinput">grep -H -n ATTGGAGGAAAGATGAGTGAC HWI-ST1027_129_D0THKACXX.1_1.fastq</span>
+HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
+HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
+HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
+$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC HWI-ST1027_129_D0THKACXX.1_1.fastq</span>
Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
+[...]
+ 0 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq
+ 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
+ 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
+ 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
+ 0 stderr run-command: completed with exit code 0 (success)
+[...]
</pre>
</notextile>
-h1. Usage
-
-@arv-run@ takes a command or command pipeline, along with stdin and stdout redirection, and creates an Arvados pipeline to run the command. The syntax is designed to mimic standard shell syntax, so it is usually necessary to quote the metacharacters < > and | as either \< \> and \| or '<' '>' and '|'.
+A key feature of @arv-run@ is the ability to introspect the command line to determine which arguments are file inputs, and transform those paths so they are usable inside the Arvados container. In the above example, @HWI-ST1027_129_D0THKACXX.1_2.fastq@ is transformed into @/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq@. @arv-run@ also works together with @arv-mount@ to identify that the file is already part of an Arvados collection. In this case, it will use the existing collection without any upload step. If you specify a file that is only available on the local filesystem, @arv-run@ will upload a new collection.
-@arv-run@ introspects the command line to determine which arguments are file inputs. If you specify a file that is only available on the local filesystem, it will be first uploaded to Arvados, and then the command line will be rewritten to refer to the newly uploaded file. @arv-run@ also works together with @arv-mount@ to identify if a file specified on the command line is part of an Arvados collection. If so, the command line will be rewritten to refer to the file within the collection without any upload necessary.
+If you find that @arv-run@ is incorrectly rewriting one of your command line arguments, place a backslash @\@ at the beginning of the affected argument to quote it (suppress rewriting).
-@arv-run@ will parallelize on the files listed on the command line after @--@. You may specify @--batch-size N@ after the @--@ but before listing any files to specify how many files to provide put on the command line for each task (see below for example).
+h2. Parallel tasks
-You may use stdin @<@ redirection on multiple files. This will create a separate task for each input file.
+@arv-run@ will parallelize over files listed on the command line after @--@.
-You are only permitted to supply a single file name for stdout @>@ redirection. If there are multiple tasks, their output will be collated at the end of the pipeline. Alternately, you may use "run-command":run-command.html parameter substitution in the file name to generate different filenames for each task.
+<notextile>
+<pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
+HWI-ST1027_129_D0THKACXX.1_1.fastq HWI-ST1027_129_D0THKACXX.1_2.fastq
+$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq</span>
+Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
+[...]
+ 0 stderr run-command: parallelizing on input0 with items [u'/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq', u'/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq']
+[...]
+ 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq
+ 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq
+[...]
+ 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
+ 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
+ 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
+ 1 stderr run-command: completed with exit code 0 (success)
+ 2 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq:34:CTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAG
+ 2 stderr run-command: completed with exit code 0 (success)
+</pre>
+</notextile>
-Multiple commands connected by pipes all execute in the same container. If you need to capture intermediate results of a pipe, use the @tee@ command.
+You may specify @--batch-size N@ (or the short form @-bN@) after the @--@ but before listing any files to specify how many files to provide put on the command line for each task. See "Putting it all together" below for an example.
-@arv-run@ commands always run inside a Docker image. By default, this is "arvados/jobs". Use @arv --docker-image IMG@ to specify the image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
+h2. Redirection
-Use @arv-run --dry-run@ to print out the final Arvados pipeline generated by @arv-run@ without submitting it.
+You may use standard input (@<@) and standard output (@>@) redirection. This will create a separate task for each file listed in standard input. You are only permitted to supply a single file name for stdout @>@ redirection. If there are multiple tasks with their output sent to the same file, the output will be collated at the end of the pipeline.
-By default, the pipeline will be submitted to your configured Arvado instance. Use @arv-run --local@ to run the command locally using "arv-crunch-job".
+(Note: because the syntax is designed to mimic standard shell syntax, it is necessary to quote the metacharacters @<@, @>@ and @|@ as either @\<@, @\>@ and @\|@ or @'<'@, @'>'@ and @'|'@.)
-h1. Examples
+{% include 'arv_run_redirection' %}
-Run one @grep@ task per file, with each input files piped from stdin. Redirect the output to output.txt.
+You may use "run-command":run-command.html parameter substitution in the output file name to generate different filenames for each task:
<notextile>
<pre>
-$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> output.txt</span>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
+$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> '$(task.uuid).txt'</span>
+[...]
+ 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
+ 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > qr1hi-ot0gb-iu2xgy4hkx4mmri.txt
+ 1 stderr run-command: completed with exit code 0 (success)
+ 1 stderr run-command: the following output files will be saved to keep:
+ 1 stderr run-command: 363 ./qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
+ 1 stderr run-command: start writing output to keep
+ 1 stderr upload wrote 363 total 363
+ 2 stderr run-command: completed with exit code 0 (success)
+ 2 stderr run-command: the following output files will be saved to keep:
+ 2 stderr run-command: 121 ./qr1hi-ot0gb-iu2xgy4hkx4mmri.txt
+ 2 stderr run-command: start writing output to keep
+ 2 stderr upload wrote 121 total 121
+[...]
</pre>
</notextile>
-Run @cat | grep@ once per file. Redirect the output to output.txt.
+h2. Pipes
+
+Multiple commands may be connected by pipes and execute in the same container:
<notextile>
<pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
$ <span class="userinput">arv-run cat -- *.fastq \| grep -H -n ATTGGAGGAAAGATGAGTGAC \> output.txt</span>
+[...]
+ 1 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
+ 2 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
+[...]
+</pre>
+</notextile>
+
+If you need to capture intermediate results of a pipe, use the @tee@ command.
+
+h2. Running a shell script
+
+<notextile>
+<pre>
+$ <span class="userinput">echo 'echo hello world' > hello.sh</span>
+$ <span class="userinput">arv-run /bin/sh hello.sh</span>
+Upload local files: "hello.sh"
+Uploaded to qr1hi-4zz18-23u3hxugbm71qmn
+Running pipeline qr1hi-d1hrv-slcnhq5czo764b1
+[...]
+ 0 stderr run-command: /bin/sh /keep/5d3a4131b7d8f233f2a917d8a5c3c2b2+52/hello.sh
+ 0 stderr hello world
+ 0 stderr run-command: completed with exit code 0 (success)
+[...]
</pre>
</notextile>
-Run @bwa@ for pairs of fastq files in "inputs" using the reference human_g1k_v37.fasta.
+h2. Additional options
+
+* @--docker-image IMG@ : By default, commands run inside a Docker container created from the latest "arvados/jobs" Docker image. Use this option to specify a different image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
+* @--dry-run@ : Print out the final Arvados pipeline generated by @arv-run@ without submitting it.
+* @--local@ : By default, the pipeline will be submitted to your configured Arvados instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
+* @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g. @grep@ returns 1 when no match is found). Set this to indicate that commands that return non-zero return codes should not be considered failed.
+* @--no-wait@ : Do not wait and display logs after submitting command, just exit.
+
+h2. Putting it all together: bwa mem
<notextile>
<pre>
-<span class="userinput">arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem reference/human_g1k_v37.fasta -- --batch-size 2 inputs/*.fastq \> '$(task.uuid).sam'</span>
+$ <span class="userinput">cd ~/keep/by_id/d0136bc494c21f79fc1b6a390561e6cb+2778</span>
+$ <span class="userinput">arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'</span>
+ 0 stderr run-command: parallelizing on input0 with items [[u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz'], [u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz']]
+[...]
+ 1 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz > qr1hi-ot0gb-a4bzzyqqz4ubair.sam
+ 2 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz > qr1hi-ot0gb-14j9ncw0ymkxq0v.sam
</pre>
</notextile>
projects / arvados.git / blobdiff