navsection: userguide
title: "Using arv-run"
...
+{% comment %}
+Copyright (C) The Arvados Authors. All rights reserved.
-The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvado compute nodes.
+SPDX-License-Identifier: CC-BY-SA-3.0
+{% endcomment %}
+
+{% include 'crunch1only_begin' %}
+On those sites, the features described here are not yet implemented.
+{% include 'crunch1only_end' %}
+
+The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvados compute nodes.
{% include 'tutorial_expectations' %}
<notextile>
<pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
HWI-ST1027_129_D0THKACXX.1_1.fastq HWI-ST1027_129_D0THKACXX.1_2.fastq
$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq</span>
Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
(Note: because the syntax is designed to mimic standard shell syntax, it is necessary to quote the metacharacters @<@, @>@ and @|@ as either @\<@, @\>@ and @\|@ or @'<'@, @'>'@ and @'|'@.)
-<notextile>
-<pre>
-$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> output.txt</span>
-[...]
- 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > output.txt
- 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > output.txt
- 2 stderr run-command: completed with exit code 0 (success)
- 2 stderr run-command: the following output files will be saved to keep:
- 2 stderr run-command: 121 ./output.txt
- 2 stderr run-command: start writing output to keep
- 1 stderr run-command: completed with exit code 0 (success)
- 1 stderr run-command: the following output files will be saved to keep:
- 1 stderr run-command: 363 ./output.txt
- 1 stderr run-command: start writing output to keep
- 2 stderr upload wrote 121 total 121
- 1 stderr upload wrote 363 total 363
-[..]
-</pre>
-</notextile>
+{% include 'arv_run_redirection' %}
You may use "run-command":run-command.html parameter substitution in the output file name to generate different filenames for each task:
<notextile>
<pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
$ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> '$(task.uuid).txt'</span>
[...]
1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
<notextile>
<pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
$ <span class="userinput">arv-run cat -- *.fastq \| grep -H -n ATTGGAGGAAAGATGAGTGAC \> output.txt</span>
[...]
1 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
h2. Additional options
-* @--docker-image IMG@ : By default, commands run inside a Docker container created from the latest "arvados/jobs" Docker image. Use this option to specify a different image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
+* @--docker-image IMG@ : By default, commands run based in a container created from the @default_docker_image_for_jobs@ setting on the API server. Use this option to specify a different image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@.
* @--dry-run@ : Print out the final Arvados pipeline generated by @arv-run@ without submitting it.
-* @--local@ : By default, the pipeline will be submitted to your configured Arvado instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
-* @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g. @grep@ returns 1 when no match is found). Set this to indicate that commands that return non-zero return codes should not be considered failed.
+* @--local@ : By default, the pipeline will be submitted to your configured Arvados instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@.
+* @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g., @grep@ returns 1 when no match is found). Set this to indicate that commands that return non-zero return codes should not be considered failed.
* @--no-wait@ : Do not wait and display logs after submitting command, just exit.
h2. Putting it all together: bwa mem
<notextile>
<pre>
$ <span class="userinput">cd ~/keep/by_id/d0136bc494c21f79fc1b6a390561e6cb+2778</span>
-$ <span class="userinput">arv-run --docker-image arvados/jobs-java-bwa-samtools --repository peter --script-version 3609-arv-run bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'</span>
+$ <span class="userinput">arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'</span>
0 stderr run-command: parallelizing on input0 with items [[u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz'], [u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz']]
[...]
1 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz > qr1hi-ot0gb-a4bzzyqqz4ubair.sam