--- layout: default navsection: userguide title: "Using arv-run" ... The @arv-run@ command enables you create Arvados pipelines at the command line that fan out to multiple concurrent tasks across Arvado compute nodes. {% include 'tutorial_expectations' %} h1. Usage Using @arv-run@ you can write and test command lines interactively, then insert @arv-run@ at the beginning of the command line to run the command on Arvados. For example:
$ cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142
$ ls *.fastq
HWI-ST1027_129_D0THKACXX.1_1.fastq  HWI-ST1027_129_D0THKACXX.1_2.fastq
$ grep -H -n ATTGGAGGAAAGATGAGTGAC HWI-ST1027_129_D0THKACXX.1_1.fastq
HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
$ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC HWI-ST1027_129_D0THKACXX.1_1.fastq
Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
[...]
 0 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq
 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
 0 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
 0 stderr run-command: completed with exit code 0 (success)
[...]
A key feature of @arv-run@ is the ability to introspect the command line to determine which arguments are file inputs, and transform those paths so they are usable inside the Arvados container. In the above example, @HWI-ST1027_129_D0THKACXX.1_2.fastq@ is transformed into @/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq@. @arv-run@ also works together with @arv-mount@ to identify that the file is already part of an Arvados collection. In this case, it will use the existing collection without any upload step. If you specify a file that is only available on the local filesystem, @arv-run@ will upload a new collection. If you find that @arv-run@ is incorrectly rewriting one of your command line arguments, place a backslash @\@ at the beginning of the affected argument to quote it (suppress rewriting). h2. Parallel tasks @arv-run@ will parallelize over files listed on the command line after @--@.
HWI-ST1027_129_D0THKACXX.1_1.fastq  HWI-ST1027_129_D0THKACXX.1_2.fastq
$ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq
Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
[...]
 0 stderr run-command: parallelizing on input0 with items [u'/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq', u'/keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq']
[...]
 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq
 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq
[...]
 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:14:TCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCCCAACCTA
 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:18:AACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCT
 1 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq:30:ATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACG
 1 stderr run-command: completed with exit code 0 (success)
 2 stderr /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq:34:CTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAG
 2 stderr run-command: completed with exit code 0 (success)
You may specify @--batch-size N@ (or the short form @-bN@) after the @--@ but before listing any files to specify how many files to provide put on the command line for each task. See "Putting it all together" below for an example. h2. Redirection You may use standard input (@<@) and standard output (@>@) redirection. This will create a separate task for each file listed in standard input. You are only permitted to supply a single file name for stdout @>@ redirection. If there are multiple tasks with their output sent to the same file, the output will be collated at the end of the pipeline. (Note: because the syntax is designed to mimic standard shell syntax, it is necessary to quote the metacharacters @<@, @>@ and @|@ as either @\<@, @\>@ and @\|@ or @'<'@, @'>'@ and @'|'@.)
$ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> output.txt
[...]
 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > output.txt
 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > output.txt
 2 stderr run-command: completed with exit code 0 (success)
 2 stderr run-command: the following output files will be saved to keep:
 2 stderr run-command: 121 ./output.txt
 2 stderr run-command: start writing output to keep
 1 stderr run-command: completed with exit code 0 (success)
 1 stderr run-command: the following output files will be saved to keep:
 1 stderr run-command: 363 ./output.txt
 1 stderr run-command: start writing output to keep
 2 stderr upload wrote 121 total 121
 1 stderr upload wrote 363 total 363
[..]
You may use "run-command":run-command.html parameter substitution in the output file name to generate different filenames for each task:
$ arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> '$(task.uuid).txt'
[...]
 1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
 2 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq > qr1hi-ot0gb-iu2xgy4hkx4mmri.txt
 1 stderr run-command: completed with exit code 0 (success)
 1 stderr run-command: the following output files will be saved to keep:
 1 stderr run-command:          363 ./qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
 1 stderr run-command: start writing output to keep
 1 stderr upload wrote 363 total 363
 2 stderr run-command: completed with exit code 0 (success)
 2 stderr run-command: the following output files will be saved to keep:
 2 stderr run-command:          121 ./qr1hi-ot0gb-iu2xgy4hkx4mmri.txt
 2 stderr run-command: start writing output to keep
 2 stderr upload wrote 121 total 121
[...]
h2. Pipes Multiple commands may be connected by pipes and execute in the same container:
$ arv-run cat -- *.fastq \| grep -H -n ATTGGAGGAAAGATGAGTGAC \> output.txt
[...]
 1 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
 2 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_2.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
[...]
If you need to capture intermediate results of a pipe, use the @tee@ command. h2. Running a shell script
$ echo 'echo hello world' > hello.sh
$ arv-run /bin/sh hello.sh
Upload local files: "hello.sh"
Uploaded to qr1hi-4zz18-23u3hxugbm71qmn
Running pipeline qr1hi-d1hrv-slcnhq5czo764b1
[...]
 0 stderr run-command: /bin/sh /keep/5d3a4131b7d8f233f2a917d8a5c3c2b2+52/hello.sh
 0 stderr hello world
 0 stderr run-command: completed with exit code 0 (success)
[...]
h2. Additional options * @--docker-image IMG@ : By default, commands run inside a Docker container created from the latest "arvados/jobs" Docker image. Use this option to specify a different image to use. Note: the Docker image must be uploaded to Arvados using @arv keep docker@. * @--dry-run@ : Print out the final Arvados pipeline generated by @arv-run@ without submitting it. * @--local@ : By default, the pipeline will be submitted to your configured Arvado instance. Use this option to run the command locally using @arv-run-pipeline-instance --run-jobs-here@. * @--ignore-rcode@ : Some commands use non-zero exit codes to indicate nonfatal conditions (e.g. @grep@ returns 1 when no match is found). Set this to indicate that commands that return non-zero return codes should not be considered failed. * @--no-wait@ : Do not wait and display logs after submitting command, just exit. h2. Putting it all together: bwa mem
$ cd ~/keep/by_id/d0136bc494c21f79fc1b6a390561e6cb+2778
$ arv-run --docker-image arvados/jobs-java-bwa-samtools bwa mem ../3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta -- --batch-size 2 *.fastq.gz \> '$(task.uuid).sam'
 0 stderr run-command: parallelizing on input0 with items [[u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz'], [u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz', u'/keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz']]
[...]
 1 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.1_2.fastq.gz > qr1hi-ot0gb-a4bzzyqqz4ubair.sam
 2 stderr run-command: bwa mem /keep/3514b8e5da0e8d109946bc809b20a78a+5698/human_g1k_v37.fasta /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_1.fastq.gz /keep/d0136bc494c21f79fc1b6a390561e6cb+2778/HWI-ST1027_129_D0THKACXX.2_2.fastq.gz > qr1hi-ot0gb-14j9ncw0ymkxq0v.sam